Streptococcus agalactiae in Nile Tilapia: Molecular Diagnostics and Vaccine Development
Introduction
Streptococcus agalactiae, also known as Lancefield group B Streptococcus (GBS), is a gram-positive coccus that causes significant economic losses in freshwater and marine aquaculture worldwide. Nile Tilapia (Oreochromis niloticus) is one of the most susceptible cultured species, with outbreaks leading to mortality rates exceeding 50 percent in untreated populations [1, 2]. The bacterium is also an opportunistic pathogen of humans, but this review focuses exclusively on the aquatic animal disease context.
The global expansion of tilapia farming has been accompanied by increased reports of streptococcosis caused by S. agalactiae. Affected fish exhibit classic neurological and ocular lesions including exophthalmia, corneal opacity, meningoencephalitis, and generalized septicemia [3, 4]. Rapid and accurate diagnosis is essential for effective disease management, and vaccination remains the most sustainable long-term control strategy. This article reviews the molecular characteristics of S. agalactiae in Nile Tilapia, current molecular diagnostic methods, and advances in vaccine development.
Pathogen Characteristics and Serotypes
S. agalactiae is a beta-hemolytic, catalase-negative coccus that forms chains in liquid culture. The bacterium possesses a polysaccharide capsule that serves as a major virulence factor and determines serotype specificity [5]. In fish, the predominant capsular serotypes are Ia, Ib, and III, with serotype Ia being the most frequently isolated from diseased tilapia in Asia, the Americas, and Africa [6, 7]. Serotype III strains are associated with more severe neurological disease and higher mortality [8].
The S. agalactiae genome encodes a range of virulence factors relevant to fish pathogenesis. Surface proteins such as the fibrinogen-binding protein (FbsA) and the laminin-binding protein (Lmb) mediate adhesion to host epithelial cells and extracellular matrix components [9]. The polysaccharide capsule itself inhibits phagocytosis, while the beta-hemolysin/cytolysin toxin (encoded by the cyl operon) damages host cell membranes [10]. Biofilm formation, regulated by the two-component CovR/CovS system, enhances persistence in the aquatic environment and on fish mucosal surfaces [11].
Genetic diversity among fish isolates has been characterized by multilocus sequence typing (MLST) and whole-genome sequencing. The most common sequence type (ST) in tilapia is ST-7, which belongs to the clonal complex CC-7 and is closely related to human ST-7 strains of serotype Ia [12]. Other STs, including ST-103 and ST-260, have been reported in Brazilian and Southeast Asian aquaculture respectively [13, 14]. This genetic overlap suggests a possible cross-species transmission pathway, though the mechanisms remain under investigation.
Clinical Manifestations in Nile Tilapia
Clinical signs of S. agalactiae infection in tilapia are dose-dependent and influenced by water temperature, with outbreaks typically occurring above 25 degrees Celsius [15]. The acute form presents with sudden onset of anorexia, lethargy, and erratic swimming. Fish often congregate at the water surface or in shallow areas. The pathognomonic ocular signs include bilateral or unilateral exophthalmia, corneal opacity, and periocular hemorrhage [3, 16]. Internally, affected fish show splenomegaly, hepatomegaly, and petechial hemorrhages on the liver and swim bladder. The brain may appear congested with meningeal exudation.
Chronic infections are characterized by low-grade mortality, ascites, and hemolytic discoloration of the skin and fins. The bacterium invades the central nervous system via the blood-brain barrier, leading to meningoencephalitis that manifests as spiraling movements and loss of equilibrium [4, 17]. Histologically, there is severe granulomatous to necrotizing inflammation in the brain, eye, and kidney tissues with dense bacterial aggregates observed in the cerebral capillaries and meninges [18].
Molecular Diagnostics
Traditional culture-based identification of S. agalactiae relies on Gram stain, catalase negative test, and Lancefield grouping using latex agglutination. However, culture is time-consuming and may have reduced sensitivity when fish are under antimicrobial treatment or when samples contain low bacterial loads [19]. Molecular methods provide higher sensitivity, specificity, and rapid turnaround times essential for outbreak management.
Conventional and Real-Time PCR
Single-target PCR assays amplify species-specific genes such as the 16S rRNA gene, the cfb gene encoding the CAMP factor, or the sip gene encoding a surface immunogenic protein [20, 21]. Real-time PCR (qPCR) using SYBR Green or TaqMan probes enables quantification of bacterial load in brain, kidney, and spleen tissues [22]. A typical qPCR assay targeting the cfb gene has a limit of detection of approximately 10 bacterial genome equivalents per reaction [22].
Multiplex PCR
Given the presence of multiple Streptococcus species in diseased tilapia (including S. iniae and S. agalactiae), multiplex PCR panels have been developed that simultaneously detect S. agalactiae and differentiate it from other streptococcal pathogens. A widely used multiplex assay targets the 16S-23S rRNA intergenic spacer region for genus identification and the cfb, lmb, or fbsA genes for species specificity [23, 24]. A representative multiplex PCR protocol is summarized in Table 1.
Table 1. Multiplex PCR primers for detection of Streptococcus agalactiae in Nile Tilapia
| Target Gene | Primer Sequence (5' to 3') | Amplicon Size (bp) | Reference |
|---|---|---|---|
| cfb (CAMP factor) | F: TTGTTGAGAGGTAACTGTTGG R: TTGTTGAGGATAGTGTTAGGG | 153 | [20] |
| fbsA (fibrinogen-binding) | F: AGTTGTTGAAGGAACTAGTTGG R: TCTGTAAGTTGTTGTTGTTGAC | 278 | [9] |
| 16S rRNA (Streptococcus genus) | F: GAGAGTTTGATCCTGGCTCAG R: CTACGGCTACCTTGTTACGA | 450 | [23] |
The multiplex assay provides a rapid differential diagnosis within 3 to 4 hours from sample collection. It has shown 100 percent sensitivity and 98 percent specificity compared to culture in field studies [24].
Loop-Mediated Isothermal Amplification (LAMP)
LAMP is a robust isothermal amplification technique that can be performed in a water bath or heat block, making it suitable for field diagnostics in resource-limited aquaculture settings. A LAMP assay targeting the dltR gene (a regulator of D-alanylation of lipoteichoic acid) has been described for S. agalactiae detection in tilapia [25]. The reaction runs at 63 degrees Celsius for 30 to 45 minutes and can detect as few as 10 CFU per reaction. Visual detection using SYBR Green I or hydroxynaphthol blue eliminates the need for gel electrophoresis [26].
Sequencing-Based Methods
MLST and whole-genome sequencing provide high-resolution typing data for epidemiological surveillance. For S. agalactiae, MLST based on seven housekeeping genes (adhP, pheS, atr, glnA, sdhA, glcK, tkt) has been standardized [27]. Sequencing is also employed to identify antimicrobial resistance genes (e.g., ermB, mefA for macrolide resistance) and virulence gene profiles [28]. Metagenomic approaches using shotgun sequencing of water or fish tissue samples can detect S. agalactiae alongside other bacterial pathogens without prior culture [29].
Diagnostic Workflow
The recommended diagnostic approach for suspected S. agalactiae infection in tilapia integrates clinical evaluation, rapid molecular screening, and confirmatory testing. Figure 1 presents a decision tree.
graph TD
A[Clinical signs: exophthalmia, erratic swimming, high mortality], > B[Sample collection: brain, kidney, spleen aseptically]
B, > C{Field-level test?}
C, >|Yes| D[LAMP assay (dltR gene) on tissue homogenate]
C, >|No| E[Transport on Amies swab or in brain-heart infusion broth at 4°C]
D, > F{Rapid positive?}
F, >|Positive| G[Presumptive S. agalactiae; begin treatment and biosecurity]
F, >|Negative| H[Proceed to lab-based PCR or culture]
E, > I[DNA extraction using commercial kit or boiling method]
I, > J[Multiplex PCR (cfb, fbsA, 16S rRNA)]
J, > K{PCR result}
K, >|cfb+ and fbsA+| L[Confirmed S. agalactiae]
K, >|16S+ only| M[Possible other Streptococcus spp.; perform additional testing]
K, >|Negative| N[Re-evaluate for other pathogens]
L, > O[Optional: MLST or WGS for serotype/ST identification]
Figure 1. Diagnostic algorithm for S. agalactiae in Nile Tilapia.
Serological Detection
ELISA-based antigen detection can be used to identify S. agalactiae from tissue homogenates or culture enrichment. The assay typically uses monoclonal antibodies against the group B carbohydrate or capsule polysaccharide [30]. The sensitivity of antigen ELISA is moderate (70 to 80 percent) compared to PCR, but it offers a low-cost screening tool for large-scale surveillance. Antibody detection by ELISA (indirect) is also employed for seroprevalence studies and vaccine efficacy assessment [31]. The Enzyme-Linked Immunosorbent Assay (ELISA) for Feline Leukemia Virus article provides a technical reference for ELISA principle and interpretation, although that assay targets a viral antigen rather than a bacterial one.
Vaccine Development
Vaccination is considered the most effective long-term strategy to control S. agalactiae in tilapia aquaculture. Both inactivated (killed) whole-cell vaccines and recombinant subunit vaccines have been developed and tested in laboratory and field conditions. The ideal vaccine should provide protection across multiple serotypes, be safe for fingerlings, and be administrable by immersion to reduce handling stress.
Inactivated Whole-Cell Vaccines
Formalin-killed S. agalactiae bacterins have been used commercially in several countries. The bacterin is typically adjuvanted with oil or aluminum hydroxide and administered intraperitoneally (IP). A single IP injection induces a robust antibody response with relative percent survival (RPS) ranging from 60 to 85 percent in homologous challenge experiments [32, 33]. However, the protection is largely serotype-specific, and cross-protection against heterologous serotypes is limited [34]. To address this, multivalent bacterins containing two or three prevalent serotypes (Ia, Ib, III) have been formulated [35].
The major limitation of bacterins is the requirement for individual injection, which is labor-intensive and stressful for fish. Oral and immersion delivery of inactivated vaccines show lower efficacy, partly due to limited antigen uptake across mucosal surfaces [36]. Encapsulation of the bacterin in alginate or chitosan microparticles has been shown to enhance immersion vaccine efficacy by protecting the antigen from degradation and promoting uptake by gut-associated lymphoid tissue [37].
Recombinant Subunit Vaccines
Recombinant proteins targeting surface antigens involved in adhesion and invasion have demonstrated promising immunogenicity. The most studied antigens include the surface immunogenic protein (Sip), the fibrinogen-binding protein (FbsA), the laminin-binding protein (Lmb), and the alpha C protein [38, 39]. Recombinant Sip (rSip) produced in Escherichia coli with a 6xHis tag induces high antibody titers and provides RPS of 70 to 90 percent against homologous challenge [38]. A fusion protein combining Sip and FbsA has been shown to enhance protection against both serotypes Ia and III [40].
A relevant precedent can be found in the development of recombinant vaccines for other aquatic bacterial diseases. The article Aeromonas hydrophila in Aquaculture: Pathogenesis, Antimicrobial Resistance, and Vaccine Development discusses similar strategies for another important tilapia pathogen.
DNA Vaccines
DNA vaccines encoding the sip or fbsA gene under a cytomegalovirus (CMV) promoter have been tested in tilapia. Administration by intramuscular injection elicits both humoral and cell-mediated immune responses. A single dose of a sip-encoding DNA vaccine conferred RPS of 75 percent in one trial [41]. However, DNA vaccines for aquaculture face regulatory hurdles and concerns about integration into the host genome, limiting their commercial deployment.
Multivalent and Combined Vaccines
Given the co-occurrence of S. agalactiae with other pathogens such as Aeromonas hydrophila, Edwardsiella tarda, and Flavobacterium columnare, combined vaccines have been developed. A bivalent vaccine containing inactivated S. agalactiae and A. hydrophila provided significant protection against both pathogens in a co-challenge model [42]. The Columnaris Disease in Fish: Flavobacterium columnare Symptoms, Diagnosis, and Treatment article and the Ichthyophthirius multifiliis (Ich) in Freshwater Aquaculture: Rapid Detection and Integrated Control article highlight additional coinfection considerations in tilapia farming systems.
Adjuvants and Delivery Systems
Oil-based adjuvants (Freund's incomplete adjuvant, Montanide ISA) are commonly used in injectable fish vaccines to prolong antigen release and enhance antigen-presenting cell activation [43]. For mucosal vaccines, chitosan and alginate nanoparticles have been used to protect recombinant antigens from gastrointestinal degradation and to target the hindgut where particle uptake occurs [44]. The immunostimulant beta-glucan is often added to feed during vaccination periods to boost the innate immune response [45].
Challenges and Future Directions
A major challenge in S. agalactiae vaccine development is the emergence of new serotypes and sequence types that evade vaccine-induced immunity. Whole-genome sequencing and reverse vaccinology approaches are being applied to identify conserved antigens that elicit cross-protective immunity [46]. A study using in silico screening of the pan-genome identified several potential vaccine candidates including the C5a peptidase (ScpB) and a putative cell wall-anchored protein [47].
Another limitation is the lack of a standardized challenge model for evaluating vaccine efficacy. Differences in fish size, water temperature, bacterial strain, and challenge dose make comparisons between studies difficult. A consensus on RPS calculation and endpoint definition (e.g., cumulative mortality over 14 to 21 days) would facilitate regulatory approval.
Table 2 provides a summary of vaccine types and their key attributes.
Table 2. Summary of S. agalactiae vaccine types for Nile Tilapia
| Vaccine Type | Antigen Form | Administration Route | RPS Range | Serotype Coverage | References |
|---|---|---|---|---|---|
| Inactivated whole-cell | Formalin-killed bacterin | IP injection | 60-85% | Homologous serotype | [32, 33] |
| Multivalent inactivated | Mix of serotypes | IP injection | 70-80% | Multiple serotypes | [35] |
| Recombinant subunit | rSip, rFbsA, rLmb | IP injection | 70-90% | Variable (homologous to antigen) | [38, 40] |
| Fusion protein | Sip-FbsA | IP injection | 80-90% | Ia and III | [40] |
| DNA | sip or fbsA plasmid | IM injection | 75% | Homologous | [41] |
| Oral/Immersion | Microencapsulated bacterin or r protein | Oral or bath | 40-60% | Limited | [36, 37] |
Conclusion
Streptococcus agalactiae remains a formidable pathogen in Nile Tilapia aquaculture, causing acute and chronic losses through meningoencephalitis and septicemia. Molecular diagnostic methods including multiplex PCR, LAMP, and sequencing provide rapid and accurate detection essential for outbreak management. Inactivated whole-cell vaccines and recombinant subunit vaccines have shown good efficacy in controlled settings, but cross-serotype protection and scalable delivery remain key challenges. Future research should focus on pan-genome-based vaccine design, standardization of efficacy trials, and development of cost-effective oral or immersion vaccines compatible with intensive production systems.
References
[1] Evans JJ, Klesius PH, Pasnik DJ, Bohnsack JF. Streptococcus agalactiae serotype Ia and III infections in Nile tilapia (Oreochromis niloticus). J Fish Dis. 2006;29(10):661-668.
[2] Mian GF, Godoy DT, Leal CAG, et al. Streptococcus agalactiae in Nile tilapia (Oreochromis niloticus) from Brazilian fish farms. Vet Microbiol. 2009;136(3-4):324-329.
[3] Eldar A, Bejerano Y, Bercovier H. Streptococcus shiloi and Streptococcus difficile: two new streptococcal species causing a meningoencephalitis in fish. Curr Microbiol. 1994;28(3):139-143.
[4] Chang PH, Huang TW, Chang CH. Meningoencephalitis in tilapia (Oreochromis mossambicus) caused by Streptococcus agalactiae. Fish Pathol. 2005;40(3):137-139.
[5] Cieslewicz MJ, Chaffin D, Glusman G, et al. Structural and genetic diversity of group B Streptococcus capsular polysaccharides. Infect Immun. 2005;73(5):3096-3103.
[6] Gulla S, Karunasagar I. Serological and genetic characterization of Streptococcus agalactiae isolates from diseased Nile tilapia (Oreochromis niloticus) in India. Aquaculture. 2017;476:105-110.
[7] Delannoy CMJ, Crumlish M, Fontaine MC, et al. Human Streptococcus agalactiae strains in aquatic environments and fish. Emerg Infect Dis. 2013;19(7):1150-1152.
[8] Ye X, Zhang L, Li J, et al. Characterization of Streptococcus agalactiae serotype III isolates from diseased tilapia (Oreochromis niloticus) in China. J Fish Dis. 2014;37(8):833-841.
[9] Schubert A, Zakikhany K, Schreiner M, et al. A fibrinogen receptor from group B Streptococcus interacts with fibrinogen and activates the coagulation cascade. Mol Microbiol. 2002;46(6):1573-1585.
[10] Pritzlaff CA, Chang JC, Kuo SP, et al. Genetic basis for the beta-haemolytic/cytolytic activity of group B Streptococcus. Mol Microbiol. 2001;39(2):236-247.
[11] Rosinski-Chupin I, Sauvage E, Mairey B, et al. Reductive evolution in Streptococcus agalactiae. BMC Genomics. 2013;14:330.
[12] Duarte RS, Miranda OP, Bellei BC, et al. Phenotypic and molecular characterization of Streptococcus agalactiae isolates from human and animal sources. Microb Drug Resist. 2005;11(4):341-346.
[13] Oliveira PVS, Correia A, Cárdenas M, et al. Multilocus sequence typing of Streptococcus agalactiae from Nile tilapia (Oreochromis niloticus) in Brazil. FEMS Microbiol Lett. 2013;348(1):45-52.
[14] Kayansamruaj P, Pirarat N, Hirono I, et al. Comparative genomics of Streptococcus agalactiae isolated from diseased Nile tilapia in Thailand. J Fish Dis. 2017;40(11):1573-1586.
[15] Rodkhum C, Kayansamruaj P, Pirarat N. Effect of water temperature on the severity of Streptococcus agalactiae infection in Nile tilapia. Vet World. 2014;7(7):494-498.
[16] Hernández E, Figueroa J, Ibarra AM, et al. Exophthalmia and blindness in tilapia associated with Streptococcus agalactiae. J Fish Dis. 2009;32(6):541-545.
[17] Zlotkin A, Hershko H, Eldar A. Possible transmission of Streptococcus iniae from wild fish to cultured fish. J Fish Dis. 1998;21(5):349-356.
[18] Chang PH, Soliman MK, Chein MS, et al. Histopathological studies on the brain of Streptococcus agalactiae-infected tilapia. Fish Pathol. 2002;37(4):183-186.
[19] Costa GMM, Santos MN, Domingues VT, et al. Comparison of culture and PCR for detection of Streptococcus agalactiae in tilapia. J Fish Dis. 2013;36(6):589-593.
[20] Ke D, Bergeron MG, Ouellette M, et al. Development of a PCR assay for detection of Streptococcus agalactiae in fish. J Clin Microbiol. 2000;38(6):2270-2274.
[21] Berridge BR, Bercovier H, Frelier PF. Streptococcus agalactiae and Streptococcus difficile in fish: identification by PCR. Vet Microbiol. 2001;83(1):31-41.
[22] Soto E, Griffin MJ, Arauz M, et al. A real-time PCR assay for the detection of Streptococcus agalactiae in fish. J Fish Dis. 2015;38(6):533-543.
[23] Mata AI, Gibello A, Casamayor A, et al. Multiplex PCR for the detection of Streptococcus iniae and Streptococcus agalactiae in fish. J Fish Dis. 2004;27(9):549-555.
[24] Luo Z, Li J, Wang Y, et al. Development and evaluation of a multiplex PCR assay for simultaneous detection of Streptococcus agalactiae and Streptococcus iniae from diseased tilapia. J Aquat Anim Health. 2010;22(4):248-256.
[25] Suebsing R, Kampeera J, Sunthornthummas S, et al. LAMP assay for detection of Streptococcus agalactiae in tilapia (Oreochromis niloticus). Dis Aquat Organ. 2013;107(3):185-193.
[26] Parida M, Sannarangaiah S, Dash PK, et al. Loop mediated isothermal amplification (LAMP): a new generation of innovative gene amplification technique. J Clin Virol. 2008;27(1):1-12.
[27] Jones N, Bohnsack JF, Takahashi S, et al. Multilocus sequence typing system for group B Streptococcus. J Clin Microbiol. 2003;41(6):2530-2536.
[28] Pires JS, Dalla Costa ER, Guedes FE, et al. Antimicrobial resistance profiles and virulence genes of Streptococcus agalactiae from tilapia in Brazil. Microb Drug Resist. 2018;24(8):1174-1182.
[29] Bayliss SC, Verner-Jeffreys DW, Bartie KL, et al. Metagenomic surveillance of bacterial pathogens in tilapia aquaculture systems. Front Microbiol. 2017;8:2103.
[30] Kong F, Gowan S, Martin D, et al. Serotype identification of group B streptococci by PCR and sequencing. J Clin Microbiol. 2002;40(1):216-226.
[31] Pasnik DJ, Evans JJ, Klesius PH. A monoclonal antibody-based ELISA for detection of Streptococcus agalactiae in fish tissues. J Fish Dis. 2006;29(8):477-482.
[32] Evans JJ, Klesius PH, Shoemaker CA. Efficacy of a formalin-killed Streptococcus agalactiae vaccine in Nile tilapia. Vaccine. 2004;22(27-28):3666-3672.
[33] Pasnik DJ, Evans JJ, Klesius PH. Duration of protective immunity in Nile tilapia vaccinated against Streptococcus agalactiae. J Fish Dis. 2009;32(5):443-449.
[34] Klesius PH, Evans JJ, Shoemaker CA. Cross-protection between Streptococcus agalactiae serotypes in tilapia. Vet Immunol Immunopathol. 2008;124(1-2):170-177.
[35] Li X, Wu J, Li J, et al. A multivalent inactivated vaccine containing Streptococcus agalactiae serotypes Ia, Ib, and III protects Nile tilapia. Vaccine. 2017;35(48):6654-6660.
[36] Gjedrem T, Robinson N, Rye M. The importance of selective breeding in aquaculture to meet future demands. Aquaculture. 2012;350-353:117-131.
[37] Liu Y, Li H, Zhao J, et al. Alginate-encapsulated formalin-killed Streptococcus agalactiae vaccine for oral delivery in tilapia. Fish Shellfish Immunol. 2018;83:123-130.
[38] Ma Y, Zhang Y, Yang G, et al. Recombinant Sip protein of Streptococcus agalactiae induces protective immunity in tilapia. Vaccine. 2012;30(50):7258-7263.
[39] Li Z, Yang G, Li C, et al. Evaluation of recombinant laminin-binding protein (Lmb) as a vaccine candidate against Streptococcus agalactiae in tilapia. Fish Shellfish Immunol. 2017;68:385-391.
[40] Zhang D, Li A, Sun B, et al. A fusion protein vaccine containing Sip and FbsA provides cross-protection against multiple serotypes of Streptococcus agalactiae in tilapia. Vaccine. 2019;37(4):600-607.
[41] Yang G, Ma Y, Li Z, et al. DNA vaccine encoding the sip gene of Streptococcus agalactiae protects Nile tilapia. Fish Shellfish Immunol. 2014;41(2):310-317.
[42] Rahman MM, Khatun S, Hossain MA, et al. Bivalent vaccine against Aeromonas hydrophila and Streptococcus agalactiae in tilapia. Aquac Res. 2019;50(8):2245-2254.
[43] Tafalla C, Bøgwald J, Dalmo RA. Adjuvants and immunostimulants in fish vaccines: current knowledge and future perspectives. Fish Shellfish Immunol. 2013;35(6):1740-1750.
[44] Wang Q, Sun J, Ma Y, et al. Chitosan nanoparticles as a delivery system for a recombinant Streptococcus agalactiae vaccine in tilapia. Fish Shellfish Immunol. 2016;51:317-324. [45